International Science Index

Using SNAP and RADTRAD to Establish the Analysis Model for Maanshan PWR Plant
In this study, we focus on the establishment of the analysis model for Maanshan PWR nuclear power plant (NPP) by using RADTRAD and SNAP codes with the FSAR, manuals, and other data. In order to evaluate the cumulative dose at the Exclusion Area Boundary (EAB) and Low Population Zone (LPZ) outer boundary, Maanshan NPP RADTRAD/SNAP model was used to perform the analysis of the DBA LOCA case. The analysis results of RADTRAD were similar to FSAR data. These analysis results were lower than the failure criteria of 10 CFR 100.11 (a total radiation dose to the whole body, 250 mSv; a total radiation dose to the thyroid from iodine exposure, 3000 mSv).
Paper Detail
The Study of Ultimate Response Guideline of Kuosheng BWR/6 Nuclear Power Plant Using TRACE and SNAP
In this study of ultimate response guideline (URG), Kuosheng BWR/6 nuclear power plant (NPP) TRACE model was established. The reactor depressurization, low pressure water injection, and containment venting are the main actions of URG. This research focuses to evaluate the efficiency of URG under Fukushima-like conditions. Additionally, the sensitivity study of URG was also performed in this research. The analysis results of TRACE present that URG can keep the peak cladding temperature (PCT) below 1088.7 K (the failure criteria) under Fukushima-like conditions. It implied that Kuosheng NPP was at the safe situation.
Paper Detail
The Mitigation Strategy Analysis of Kuosheng Nuclear Power Plant Spent Fuel Pool Using MELCOR2.1/SNAP

Kuosheng nuclear power plant (NPP) is a BWR/6 plant in Taiwan. There is more concern for the safety of Spent Fuel Pools (SFPs) in Taiwan after Fukushima event. In order to estimate the safety of Kuosheng NPP SFP, by using MELCOR2.1 and SNAP, the safety analysis of Kuosheng NPP SFP was performed combined with the mitigation strategy of NEI 06-12 report. There were several steps in this research. First, the Kuosheng NPP SFP models were established by MELCOR2.1/SNAP. Second, the Station Blackout (SBO) analysis of Kuosheng SFP was done by TRACE and MELCOR under the cooling system failure condition. The results showed that the calculations of MELCOR and TRACE were very similar in this case. Second, the mitigation strategy analysis was done with the MELCOR model by following the NEI 06-12 report. The results showed the effectiveness of NEI 06-12 strategy in Kuosheng NPP SFP. Finally, a sensitivity study of SFP quenching was done to check the differences of different water injection time and the phenomena during the quenching. The results showed that if the cladding temperature was over 1600 K, the water injection may have chance to cause the accident more severe with more hydrogen generation. It was because of the oxidation heat and the “Breakaway” effect of the zirconium-water reaction. An animation model built by SNAP was also shown in this study.

Paper Detail
The Establishment of RELAP5/SNAP Model for Kuosheng Nuclear Power Plant

After the measurement uncertainty recapture (MUR) power uprates, Kuosheng nuclear power plant (NPP) was uprated the power from 2894 MWt to 2943 MWt. For power upgrade, several codes (e.g., TRACE, RELAP5, etc.) were applied to assess the safety of Kuosheng NPP. Hence, the main work of this research is to establish a RELAP5/MOD3.3 model of Kuosheng NPP with SNAP interface. The establishment of RELAP5/SNAP model was referred to the FSAR, training documents, and TRACE model which has been developed and verified before. After completing the model establishment, the startup test scenarios would be applied to the RELAP5/SNAP model. With comparing the startup test data and TRACE analysis results, the applicability of RELAP5/SNAP model would be assessed.

Paper Detail
The Model Establishment and Analysis of TRACE/MELCOR for Kuosheng Nuclear Power Plant Spent Fuel Pool

Kuosheng nuclear power plant (NPP) is a BWR/6 plant in Taiwan. There is more concern for the safety of NPPs in Taiwan after Japan Fukushima NPP disaster occurred. Hence, in order to estimate the safety of Kuosheng NPP spent fuel pool (SFP), by using TRACE, MELCOR, and SNAP codes, the safety analysis of Kuosheng NPP SFP was performed. There were two main steps in this research. First, the Kuosheng NPP SFP models were established. Second, the transient analysis of Kuosheng SFP was done by TRACE and MELCOR under the cooling system failure condition (Fukushima-like condition). The results showed that the calculations of MELCOR and TRACE were very similar in this case, and the fuel uncover happened roughly at 4th day after the failure of cooling system. The above results indicated that Kuosheng NPP SFP may be unsafe in the case of long-term SBO situation. In addition, future calculations were needed to be done by the other codes like FRAPTRAN for the cladding calculations.

Paper Detail
The Model Establishment and Analysis of TRACE/FRAPTRAN for Chinshan Nuclear Power Plant Spent Fuel Pool
TRACE is developed by U.S. NRC for the nuclear power plants (NPPs) safety analysis. We focus on the establishment and application of TRACE/FRAPTRAN/SNAP models for Chinshan NPP (BWR/4) spent fuel pool in this research. The geometry is 12.17 m × 7.87 m × 11.61 m for the spent fuel pool. In this study, there are three TRACE/SNAP models: one-channel, two-channel, and multi-channel TRACE/SNAP model. Additionally, the cooling system failure of the spent fuel pool was simulated and analyzed by using the above models. According to the analysis results, the peak cladding temperature response was more accurate in the multi-channel TRACE/SNAP model. The results depicted that the uncovered of the fuels occurred at 2.7 day after the cooling system failed. In order to estimate the detailed fuel rods performance, FRAPTRAN code was used in this research. According to the results of FRAPTRAN, the highest cladding temperature located on the node 21 of the fuel rod (the highest node at node 23) and the cladding burst roughly after 3.7 day.
Paper Detail
NSBS: Design of a Network Storage Backup System

The first layer of defense against data loss is the backup data. This paper implements an agent-based network backup system used the backup, server-storage and server-backup agent these tripartite construction, and the snapshot and hierarchical index are used in the NSBS. It realizes the control command and data flow separation, balances the system load, thereby improving efficiency of the system backup and recovery. The test results show the agent-based network backup system can effectively improve the task-based concurrency, reasonably allocate network bandwidth, the system backup performance loss costs smaller and improves data recovery efficiency by 20%.

Paper Detail
Factors Associated with Mammography Screening Behaviors: A Cross-Sectional Descriptive Study of Egyptian Women

Breast cancer is considered as a substantial health concern and practicing mammography screening [MS] is important in minimizing its related morbidity. So it is essential to have a better understanding of breast cancer screening behaviors of women and factors that influence utilization of them. The aim of this study is to identify the factors that are linked to MS behaviors among the Egyptian women. A cross-sectional descriptive design was carried out to provide a snapshot of the factors that are linked to MS behaviors. A convenience sample of 311 women was utilized and all eligible participants admitted to the Women Imaging Unit who are 40 years of age or above, coming for mammography assessment, not pregnant or breast feeding and who accepted to participate in the study were included. A structured questionnaire was developed by the researchers and contains three parts; Socio-demographic data; Motivating factors associated with MS; and association between MS and model of behavior change. The analyzed data indicated that most of the participated women (66.6%) belonged to the age group of 40- 49.A high proportion of participants (58.1%) of group having previous MS influenced by their neighbors to practice MS, whereas 32.7 % in group not having previous MS were influenced by family members which indicated significant differences (P <0.05). Doctors and media shown to be the least influence of others to practice MS. Women with intention to have a future mammogram had higher OR (1.404) for practicing MS compared with women with no intention. Further studies are needed to examine the relation between Transtheoretical Model [TTM] and practicing MS.

Paper Detail
An Extensible Software Infrastructure for Computer Aided Custom Monitoring of Patients in Smart Homes

This paper describes the tradeoffs and the design from scratch of a self-contained, easy-to-use health dashboard software system that provides customizable data tracking for patients in smart homes. The system is made up of different software modules and comprises a front-end and a back-end component. Built with HTML, CSS, and JavaScript, the front-end allows adding users, logging into the system, selecting metrics, and specifying health goals. The backend consists of a NoSQL Mongo database, a Python script, and a SimpleHTTPServer written in Python. The database stores user profiles and health data in JSON format. The Python script makes use of the PyMongo driver library to query the database and displays formatted data as a daily snapshot of user health metrics against target goals. Any number of standard and custom metrics can be added to the system, and corresponding health data can be fed automatically, via sensor APIs or manually, as text or picture data files. A real-time METAR request API permits correlating weather data with patient health, and an advanced query system is implemented to allow trend analysis of selected health metrics over custom time intervals. Available on the GitHub repository system, the project is free to use for academic purposes of learning and experimenting, or practical purposes by building on it.

Paper Detail
Ensuring Consistency under the Snapshot Isolation

By running transactions under the SNAPSHOT isolation we can achieve a good level of concurrency, specially in databases with high-intensive read workloads. However, SNAPSHOT is not immune to all the problems that arise from competing transactions and therefore no serialization warranty exists. We propose in this paper a technique to obtain data consistency with SNAPSHOT by using some special triggers that we named DAEMON TRIGGERS. Besides keeping the benefits of the SNAPSHOT isolation, the technique is specially useful for those database systems that do not have an isolation level that ensures serializability, like Firebird and Oracle. We describe all the anomalies that might arise when using the SNAPSHOT isolation and show how to preclude them with DAEMON TRIGGERS. Based on the methodology presented here, it is also proposed the creation of a new isolation level: DAEMON SNAPSHOT.

Paper Detail
Genetic Polymorphisms and Haplotype Structure of the Organic Cation Transporter 1 Gene in the Zulu Population of South Africa

Organic cation transporter (OCT) 1could influence an individual’s response to various treatments and increase their susceptibility to diseases.Genotypic and allelic frequencies of nineteen non-synonymous and one intronic Single Nucleotide Polymorphism (SNP) from the OCT1 gene were determined in 101 unrelated healthy Zulu participants, using a SNaPshot® multiplex assay. Minor allele frequencies (MAF)were compared to representative populations of Africa, Asia and Europe, from Ensembl. MAFs for S14F, V519F, rs622342 and P341L were 2.0%, 6.0%, 6.0% and 1.0%, respectively. Sixteen of nineteen investigated non-synonymous SNPs were monomorphic. No study participant harbored variant alleles for S189L, G220V, P283L, G401S, M420V, M440I, G465R, I542V, R61C, R287G, C88S, A306T, A413V, I421F, C436F and V501E. Haplotype, CGTCGCCGCGCAAGAGGTGA, was most frequently observed (81.23%).Further investigations are encouraged to evaluate potential roles these SNPs could play in the therapeutic efficacy of clinically important drugs and in the development of various diseases in the Zulu population.

Paper Detail
Turbine Trip without Bypass Analysis of Kuosheng Nuclear Power Plant Using TRACE Coupling with FRAPTRAN

This analysis of Kuosheng nuclear power plant (NPP) was performed mainly by TRACE, assisted with FRAPTRAN and FRAPCON. SNAP v2.2.1 and TRACE v5.0p3 are used to develop the Kuosheng NPP SPU TRACE model which can simulate the turbine trip without bypass transient. From the analysis of TRACE, the important parameters such as dome pressure, coolant temperature and pressure can be determined. Through these parameters, comparing with the criteria which were formulated by United States Nuclear Regulatory Commission (U.S. NRC), we can determine whether the Kuoshengnuclear power plant failed or not in the accident analysis. However, from the data of TRACE, the fuel rods status cannot be determined. With the information from TRACE and burn-up analysis obtained from FRAPCON, FRAPTRAN analyzes more details about the fuel rods in this transient. Besides, through the SNAP interface, the data results can be presented as an animation. From the animation, the TRACE and FRAPTRAN data can be merged together that may be realized by the readers more easily. In this research, TRACE showed that the maximum dome pressure of the reactor reaches to 8.32 MPa, which is lower than the acceptance limit 9.58 MPa. Furthermore, FRAPTRAN revels that the maximum strain is about 0.00165, which is below the criteria 0.01. In addition, cladding enthalpy is 52.44 cal/g which is lower than 170 cal/g specified by the USNRC NUREG-0800 Standard Review Plan.

Paper Detail
Angle of Arrival Estimation Using Maximum Likelihood Method

Multiple-input multiple-output (MIMO) radar has received increasing attention in recent years. MIMO radar has many advantages over conventional phased array radar such as target detection,resolution enhancement, and interference suppression. In this paper, the results are presented from a simulation study of MIMO uniformly-spaced linear array (ULA) antennas. The performance is investigated under varied parameters, including varied array size, pseudo random (PN) sequence length, number of snapshots, and signal to noise ratio (SNR). The results of MIMO are compared to a traditional array antenna.

Paper Detail
Sensitivity Analysis for Direction of Arrival Estimation Using Capon and Music Algorithms in Mobile Radio Environment
An array antenna system with innovative signal processing can improve the resolution of a source direction of arrival (DoA) estimation. High resolution techniques take the advantage of array antenna structures to better process the incoming waves. They also have the capability to identify the direction of multiple targets. This paper investigates performance of the DOA estimation algorithm namely; Capon and MUSIC on the uniform linear array (ULA). The simulation results show that in Capon and MUSIC algorithm the resolution of the DOA techniques improves as number of snapshots, number of array elements, signal-to-noise ratio and separation angle between the two sources θ increases.
Paper Detail
Hybrid Approach for Memory Analysis in Windows System
Random Access Memory (RAM) is an important device in computer system. It can represent the snapshot on how the computer has been used by the user. With the growth of its importance, the computer memory has been an issue that has been discussed in digital forensics. A number of tools have been developed to retrieve the information from the memory. However, most of the tools have their limitation in the ability of retrieving the important information from the computer memory. Hence, this paper is aimed to discuss the limitation and the setback for two main techniques such as process signature search and process enumeration. Then, a new hybrid approach will be presented to minimize the setback in both individual techniques. This new approach combines both techniques with the purpose to retrieve the information from the process block and other objects in the computer memory. Nevertheless, the basic theory in address translation for x86 platforms will be demonstrated in this paper.
Paper Detail
File System-Based Data Protection Approach
As data to be stored in storage subsystems tremendously increases, data protection techniques have become more important than ever, to provide data availability and reliability. In this paper, we present the file system-based data protection (WOWSnap) that has been implemented using WORM (Write-Once-Read-Many) scheme. In the WOWSnap, once WORM files have been created, only the privileged read requests to them are allowed to protect data against any intentional/accidental intrusions. Furthermore, all WORM files are related to their protection cycle that is a time period during which WORM files should securely be protected. Once their protection cycle is expired, the WORM files are automatically moved to the general-purpose data section without any user interference. This prevents the WORM data section from being consumed by unnecessary files. We evaluated the performance of WOWSnap on Linux cluster.
Paper Detail
The Elements of the Crisis Concept
As every system conceptions the concept of crisis is based on the system of interdependent elements. These dialectic elements occur in a majority of definitions even though called differently. For further theoretical searching but also for practical utilization it is necessary to understand these elements. The paper stresses that the concept of crisis is ambiguous. There are identified and explained the elements that are generally found in most crises (disruption, precondition, triggers etc).
Paper Detail
Incentive Pay System and Economy Condition
This paper aims to initiate an analytical account of the issues of compliance with economy condition for incentive pay system application in an enterprise. Economy is considered one of the conditions for effective incentive pay system application another condition being the achievement of desired efficiency level of the incentive pay system application. Bonus pay system is discussed as an example.
Paper Detail
In-Situ Monitoring the Thermal Forming of Glass and Si Foils for Space X-Ray Telescopes
We developed a non-contact method for the in-situ monitoring of the thermal forming of glass and Si foils to optimize the manufacture of mirrors for high-resolution space x-ray telescopes. Their construction requires precise and light-weight segmented optics with angular resolution better than 5 arcsec. We used 75x25 mm Desag D263 glass foils 0.75 mm thick and 0.6 mm thick Si foils. The glass foils were shaped by free slumping on a frame at viscosities in the range of 109.3-1012 dPa·s, the Si foils by forced slumping above 1000°C. Using a Nikon D80 digital camera, we took snapshots of a foil-s shape every 5 min during its isothermal heat treatment. The obtained results we can use for computer simulations. By comparing the measured and simulated data, we can more precisely define material properties of the foils and optimize the forming technology.
Paper Detail
Topological Properties of an Exponential Random Geometric Graph Process
In this paper we consider a one-dimensional random geometric graph process with the inter-nodal gaps evolving according to an exponential AR(1) process. The transition probability matrix and stationary distribution are derived for the Markov chains concerning connectivity and the number of components. We analyze the algorithm for hitting time regarding disconnectivity. In addition to dynamical properties, we also study topological properties for static snapshots. We obtain the degree distributions as well as asymptotic precise bounds and strong law of large numbers for connectivity threshold distance and the largest nearest neighbor distance amongst others. Both exact results and limit theorems are provided in this paper.
Paper Detail
110 MW Geothermal Power Plant Multiple Simulator, Using Wireless Technology
A geothermal power plant multiple simulator for operators training is presented. The simulator is designed to be installed in a wireless local area network and has a capacity to train one to six operators simultaneously, each one with an independent simulation session. The sessions must be supervised only by one instructor. The main parts of this multiple simulator are: instructor and operator-s stations. On the instructor station, the instructor controls the simulation sessions, establishes training exercises and supervises each power plant operator in individual way. This station is hosted in a Main Personal Computer (NS) and its main functions are: to set initial conditions, snapshots, malfunctions or faults, monitoring trends, and process and soft-panel diagrams. On the other hand the operators carry out their actions over the power plant simulated on the operator-s stations; each one is also hosted in a PC. The main software of instructor and operator-s stations are executed on the same NS and displayed in PCs through graphical Interactive Process Diagrams (IDP). The geothermal multiple simulator has been installed in the Geothermal Simulation Training Center (GSTC) of the Comisi├│n Federal de Electricidad, (Federal Commission of Electricity, CFE), Mexico, and is being utilized as a part of the training courses for geothermal power plant operators.
Paper Detail
Dynamic Bayesian Networks Modeling for Inferring Genetic Regulatory Networks by Search Strategy: Comparison between Greedy Hill Climbing and MCMC Methods

Using Dynamic Bayesian Networks (DBN) to model genetic regulatory networks from gene expression data is one of the major paradigms for inferring the interactions among genes. Averaging a collection of models for predicting network is desired, rather than relying on a single high scoring model. In this paper, two kinds of model searching approaches are compared, which are Greedy hill-climbing Search with Restarts (GSR) and Markov Chain Monte Carlo (MCMC) methods. The GSR is preferred in many papers, but there is no such comparison study about which one is better for DBN models. Different types of experiments have been carried out to try to give a benchmark test to these approaches. Our experimental results demonstrated that on average the MCMC methods outperform the GSR in accuracy of predicted network, and having the comparable performance in time efficiency. By proposing the different variations of MCMC and employing simulated annealing strategy, the MCMC methods become more efficient and stable. Apart from comparisons between these approaches, another objective of this study is to investigate the feasibility of using DBN modeling approaches for inferring gene networks from few snapshots of high dimensional gene profiles. Through synthetic data experiments as well as systematic data experiments, the experimental results revealed how the performances of these approaches can be influenced as the target gene network varies in the network size, data size, as well as system complexity.

Paper Detail
SUPAR: System for User-Centric Profiling of Association Rules in Streaming Data
With a surge of stream processing applications novel techniques are required for generation and analysis of association rules in streams. The traditional rule mining solutions cannot handle streams because they generally require multiple passes over the data and do not guarantee the results in a predictable, small time. Though researchers have been proposing algorithms for generation of rules from streams, there has not been much focus on their analysis. We propose Association rule profiling, a user centric process for analyzing association rules and attaching suitable profiles to them depending on their changing frequency behavior over a previous snapshot of time in a data stream. Association rule profiles provide insights into the changing nature of associations and can be used to characterize the associations. We discuss importance of characteristics such as predictability of linkages present in the data and propose metric to quantify it. We also show how association rule profiles can aid in generation of user specific, more understandable and actionable rules. The framework is implemented as SUPAR: System for Usercentric Profiling of Association Rules in streaming data. The proposed system offers following capabilities: i) Continuous monitoring of frequency of streaming item-sets and detection of significant changes therein for association rule profiling. ii) Computation of metrics for quantifying predictability of associations present in the data. iii) User-centric control of the characterization process: user can control the framework through a) constraint specification and b) non-interesting rule elimination.
Paper Detail